ID: 1096985913_1096985919

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1096985913 1096985919
Species Human (GRCh38) Human (GRCh38)
Location 12:55757364-55757386 12:55757392-55757414
Sequence CCGCAGTTCATGGATGTACCTGG ATGCTCCCTCATTGCGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 99} {0: 1, 1: 0, 2: 1, 3: 7, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!