ID: 1097003976_1097003988

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1097003976 1097003988
Species Human (GRCh38) Human (GRCh38)
Location 12:55901813-55901835 12:55901856-55901878
Sequence CCAGACCCCAGAGAGCCCCACGG CTATTCCCCAAAGGCCTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 265} {0: 1, 1: 0, 2: 4, 3: 46, 4: 411}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!