ID: 1097014330_1097014337

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1097014330 1097014337
Species Human (GRCh38) Human (GRCh38)
Location 12:55974429-55974451 12:55974447-55974469
Sequence CCTCATTAAGCAGCGCTGAAGAG AAGAGGGAGGAGCTGGGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 83} {0: 1, 1: 1, 2: 13, 3: 174, 4: 1495}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!