ID: 1097019148_1097019156

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1097019148 1097019156
Species Human (GRCh38) Human (GRCh38)
Location 12:56007699-56007721 12:56007724-56007746
Sequence CCCCTCACAGCCTGCGCGCGCGC AGACACCTCAGGTGAGTGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 109} {0: 1, 1: 0, 2: 1, 3: 22, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!