ID: 1097023232_1097023236

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1097023232 1097023236
Species Human (GRCh38) Human (GRCh38)
Location 12:56035214-56035236 12:56035242-56035264
Sequence CCACATGGGCTGCCATGGCTTCA CCTTTTGAGTGCAACATCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 155} {0: 1, 1: 1, 2: 1, 3: 28, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!