ID: 1097030966_1097030968

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1097030966 1097030968
Species Human (GRCh38) Human (GRCh38)
Location 12:56088986-56089008 12:56089011-56089033
Sequence CCTGTTACAAAGGACCTGAAAGA GCTTAACACATCCTCCATCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 178} {0: 1, 1: 0, 2: 2, 3: 9, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!