ID: 1097051256_1097051266

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1097051256 1097051266
Species Human (GRCh38) Human (GRCh38)
Location 12:56224560-56224582 12:56224600-56224622
Sequence CCCCTGTCTACGTCGGCTCCGCC TAAAAGAGCATCCCGGCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46} {0: 1, 1: 0, 2: 0, 3: 10, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!