ID: 1097051983_1097051988

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1097051983 1097051988
Species Human (GRCh38) Human (GRCh38)
Location 12:56229157-56229179 12:56229173-56229195
Sequence CCTTCCAGCAACCCTGTTAGTAA TTAGTAACGGCAAAGAAACCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 189} {0: 1, 1: 0, 2: 1, 3: 6, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!