ID: 1097056508_1097056519

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1097056508 1097056519
Species Human (GRCh38) Human (GRCh38)
Location 12:56253220-56253242 12:56253272-56253294
Sequence CCATGGTTGATGTGAGCAGTCTG CGGGGCCCTGACTCACCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 124} {0: 1, 1: 0, 2: 0, 3: 10, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!