ID: 1097061921_1097061925

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1097061921 1097061925
Species Human (GRCh38) Human (GRCh38)
Location 12:56291642-56291664 12:56291658-56291680
Sequence CCCTGAACTTCTACCTCCCAGAT CCCAGATTCTCCCCTAATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 457} {0: 1, 1: 0, 2: 0, 3: 16, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!