ID: 1097091780_1097091784

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1097091780 1097091784
Species Human (GRCh38) Human (GRCh38)
Location 12:56511156-56511178 12:56511187-56511209
Sequence CCCTTACAATGGGGCCAAAGGGA AGTGATTATCGAGCAGAGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 1, 3: 9, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!