ID: 1097101996_1097102007

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1097101996 1097102007
Species Human (GRCh38) Human (GRCh38)
Location 12:56596458-56596480 12:56596482-56596504
Sequence CCCCGCCATATGAGTGCCTGGTC CTAGGGAAAGAGATGGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38} {0: 1, 1: 1, 2: 3, 3: 41, 4: 404}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!