ID: 1097109116_1097109121

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1097109116 1097109121
Species Human (GRCh38) Human (GRCh38)
Location 12:56645208-56645230 12:56645240-56645262
Sequence CCTGCCTTGCACTTCCAGGGCAT GTGGTAGTCCCTCATCAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 236} {0: 1, 1: 1, 2: 0, 3: 2, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!