|
Left Crispr |
Right Crispr |
| Crispr ID |
1097119814 |
1097119818 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:56722685-56722707
|
12:56722718-56722740
|
| Sequence |
CCGTCTCAAAACAAAACAAACCA |
TTGGAGTGGCGAGAATACACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 1458, 2: 1436, 3: 6592, 4: 111445} |
{0: 1, 1: 0, 2: 0, 3: 6, 4: 69} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|