ID: 1097119817_1097119818

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1097119817 1097119818
Species Human (GRCh38) Human (GRCh38)
Location 12:56722705-56722727 12:56722718-56722740
Sequence CCAAAGAAGACAATTGGAGTGGC TTGGAGTGGCGAGAATACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 124} {0: 1, 1: 0, 2: 0, 3: 6, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!