ID: 1097125779_1097125791

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1097125779 1097125791
Species Human (GRCh38) Human (GRCh38)
Location 12:56773846-56773868 12:56773893-56773915
Sequence CCTCACTATGTGGCTCTACCTGG TTCTGCACTGGTACCGGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 255} {0: 2, 1: 1, 2: 1, 3: 5, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!