ID: 1097125784_1097125789

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1097125784 1097125789
Species Human (GRCh38) Human (GRCh38)
Location 12:56773864-56773886 12:56773888-56773910
Sequence CCTGGCGGCCTTCGTGGGCCTGT CTACCTTCTGCACTGGTACCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 11, 4: 160} {0: 2, 1: 2, 2: 0, 3: 10, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!