ID: 1097125784_1097125792

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1097125784 1097125792
Species Human (GRCh38) Human (GRCh38)
Location 12:56773864-56773886 12:56773897-56773919
Sequence CCTGGCGGCCTTCGTGGGCCTGT GCACTGGTACCGGGAGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 11, 4: 160} {0: 2, 1: 1, 2: 0, 3: 17, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!