ID: 1097125785_1097125793

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1097125785 1097125793
Species Human (GRCh38) Human (GRCh38)
Location 12:56773872-56773894 12:56773900-56773922
Sequence CCTTCGTGGGCCTGTACTACCTT CTGGTACCGGGAGAGGCAGGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 74} {0: 1, 1: 1, 2: 1, 3: 51, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!