ID: 1097134599_1097134609

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1097134599 1097134609
Species Human (GRCh38) Human (GRCh38)
Location 12:56841219-56841241 12:56841259-56841281
Sequence CCACTACCAGCGCAGAAGGTAGT ATCAGGGAGAGTCCCATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 69} {0: 1, 1: 0, 2: 0, 3: 10, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!