ID: 1097134599_1097134610

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1097134599 1097134610
Species Human (GRCh38) Human (GRCh38)
Location 12:56841219-56841241 12:56841260-56841282
Sequence CCACTACCAGCGCAGAAGGTAGT TCAGGGAGAGTCCCATGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 69} {0: 1, 1: 0, 2: 1, 3: 21, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!