ID: 1097148348_1097148357

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1097148348 1097148357
Species Human (GRCh38) Human (GRCh38)
Location 12:56957400-56957422 12:56957442-56957464
Sequence CCTCTCCCGGTACCAGTGCAGAA AACCGCCAGGTAGAGCCACATGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 5, 4: 83} {0: 1, 1: 1, 2: 1, 3: 5, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!