ID: 1097155791_1097155792

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1097155791 1097155792
Species Human (GRCh38) Human (GRCh38)
Location 12:57011381-57011403 12:57011395-57011417
Sequence CCAATTCTTTGGAAGCTAGTGAA GCTAGTGAAAAGAAAGCCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 196} {0: 1, 1: 0, 2: 0, 3: 16, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!