ID: 1097174330_1097174336

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1097174330 1097174336
Species Human (GRCh38) Human (GRCh38)
Location 12:57134085-57134107 12:57134098-57134120
Sequence CCAGCTTGGTGGCCCTGGGGACC CCTGGGGACCGTGGCTGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 42, 4: 306} {0: 1, 1: 0, 2: 3, 3: 53, 4: 516}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!