ID: 1097174330_1097174348

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1097174330 1097174348
Species Human (GRCh38) Human (GRCh38)
Location 12:57134085-57134107 12:57134121-57134143
Sequence CCAGCTTGGTGGCCCTGGGGACC GTGCCTGGGTTTGGGGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 42, 4: 306} {0: 1, 1: 0, 2: 1, 3: 64, 4: 703}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!