ID: 1097174519_1097174527

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1097174519 1097174527
Species Human (GRCh38) Human (GRCh38)
Location 12:57135162-57135184 12:57135203-57135225
Sequence CCGTATTTCCAATCAGTGGCTGG AGGTTAGCTCCCATCGGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126} {0: 1, 1: 0, 2: 0, 3: 4, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!