ID: 1097178911_1097178921

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1097178911 1097178921
Species Human (GRCh38) Human (GRCh38)
Location 12:57159816-57159838 12:57159841-57159863
Sequence CCCCAACAGGCATCCACAATGTG GGGTGTGGCCGTGGACTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 102} {0: 1, 1: 0, 2: 1, 3: 13, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!