ID: 1097187347_1097187361

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1097187347 1097187361
Species Human (GRCh38) Human (GRCh38)
Location 12:57202903-57202925 12:57202944-57202966
Sequence CCCGCTCCCCTCCCCAAACACAG CCAGGGACCTGTGTCCTCTCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 124, 4: 854} {0: 1, 1: 0, 2: 4, 3: 25, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!