ID: 1097210944_1097210947

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1097210944 1097210947
Species Human (GRCh38) Human (GRCh38)
Location 12:57369145-57369167 12:57369192-57369214
Sequence CCAGCATCTTAACACCATCAAAT ATGTAGCTCCACCTCTTAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 422} {0: 1, 1: 0, 2: 5, 3: 19, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!