ID: 1097216820_1097216826

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1097216820 1097216826
Species Human (GRCh38) Human (GRCh38)
Location 12:57420612-57420634 12:57420659-57420681
Sequence CCCATAGTATTGGGATTACGGGC CTAGTTTTCCATCTATCTTTAGG
Strand - +
Off-target summary {0: 1, 1: 20, 2: 1216, 3: 29147, 4: 272957} {0: 1, 1: 0, 2: 0, 3: 50, 4: 345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!