ID: 1097248419_1097248425

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1097248419 1097248425
Species Human (GRCh38) Human (GRCh38)
Location 12:57619451-57619473 12:57619471-57619493
Sequence CCTGCTTCGTGGGAGGCGGGACT ACTCAGGGCTTAGCGGGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 266} {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!