ID: 1097249832_1097249848

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1097249832 1097249848
Species Human (GRCh38) Human (GRCh38)
Location 12:57626471-57626493 12:57626503-57626525
Sequence CCCATTTCCTGCCCCATGAGAAT GAGGACTTGGCACTGGCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 220} {0: 1, 1: 0, 2: 1, 3: 28, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!