ID: 1097260914_1097260921

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1097260914 1097260921
Species Human (GRCh38) Human (GRCh38)
Location 12:57719853-57719875 12:57719874-57719896
Sequence CCTATAGGTGACGGGCAGAATTA TATTGGGTAGGGCGGGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59} {0: 1, 1: 0, 2: 0, 3: 19, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!