ID: 1097269769_1097269784

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1097269769 1097269784
Species Human (GRCh38) Human (GRCh38)
Location 12:57766862-57766884 12:57766900-57766922
Sequence CCTCGACAGCCCCCCCTTGCAGA AGCTGGGCGTAGAGGGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 123} {0: 1, 1: 0, 2: 1, 3: 29, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!