ID: 1097281951_1097281954

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1097281951 1097281954
Species Human (GRCh38) Human (GRCh38)
Location 12:57850451-57850473 12:57850478-57850500
Sequence CCTTCTAACTTCTGCCTAAAATA CAAAAATAACATCCTGCCTACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 253} {0: 1, 1: 0, 2: 0, 3: 10, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!