ID: 1097281951_1097281957

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1097281951 1097281957
Species Human (GRCh38) Human (GRCh38)
Location 12:57850451-57850473 12:57850485-57850507
Sequence CCTTCTAACTTCTGCCTAAAATA AACATCCTGCCTACGGGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 253} {0: 1, 1: 0, 2: 1, 3: 7, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!