ID: 1097282062_1097282071

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1097282062 1097282071
Species Human (GRCh38) Human (GRCh38)
Location 12:57851133-57851155 12:57851152-57851174
Sequence CCCAGGGCAGAGTATCGGGGCTG GCTGAGATGGGGTGGGGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 136} {0: 1, 1: 0, 2: 17, 3: 158, 4: 2775}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!