ID: 1097288466_1097288469

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1097288466 1097288469
Species Human (GRCh38) Human (GRCh38)
Location 12:57895300-57895322 12:57895340-57895362
Sequence CCTGAACACACAGAGTGTCATCC AACCTATATTTTTCTTCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 115} {0: 1, 1: 0, 2: 3, 3: 37, 4: 458}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!