ID: 1097289642_1097289645

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1097289642 1097289645
Species Human (GRCh38) Human (GRCh38)
Location 12:57903795-57903817 12:57903826-57903848
Sequence CCAAGAGACTGCTGAGCAGGAGA GAGACTTCCTAAGAGCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 277} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!