ID: 1097293615_1097293618

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1097293615 1097293618
Species Human (GRCh38) Human (GRCh38)
Location 12:57941334-57941356 12:57941351-57941373
Sequence CCCACACTGGGAGGGCAGCAGCG GCAGCGAAATCCGCGGCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 205} {0: 1, 1: 0, 2: 0, 3: 2, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!