ID: 1097294423_1097294427

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1097294423 1097294427
Species Human (GRCh38) Human (GRCh38)
Location 12:57947251-57947273 12:57947298-57947320
Sequence CCTTACAGGAAAGATAAGACATG CAAGCTAAACCATTTTAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 222} {0: 1, 1: 0, 2: 0, 3: 14, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!