ID: 1097343588_1097343596

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1097343588 1097343596
Species Human (GRCh38) Human (GRCh38)
Location 12:58466977-58466999 12:58467012-58467034
Sequence CCTGTGGCTTTTCCAGGTGCACA TGTAGGGGTCTGGAGGATGGTGG
Strand - +
Off-target summary {0: 45, 1: 94, 2: 244, 3: 392, 4: 729} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!