ID: 1097357107_1097357116

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1097357107 1097357116
Species Human (GRCh38) Human (GRCh38)
Location 12:58614226-58614248 12:58614275-58614297
Sequence CCCGAAACAGCATTATCATGCAG AAAGCCTATTATGAGGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 149} {0: 1, 1: 0, 2: 1, 3: 19, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!