ID: 1097575520_1097575526

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1097575520 1097575526
Species Human (GRCh38) Human (GRCh38)
Location 12:61388510-61388532 12:61388551-61388573
Sequence CCTGAGACTGGGTAAATTATAAA CTCACAGTACCACAGGACTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 21, 2: 537, 3: 4310, 4: 7733}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!