ID: 1097589551_1097589553

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1097589551 1097589553
Species Human (GRCh38) Human (GRCh38)
Location 12:61557421-61557443 12:61557443-61557465
Sequence CCGGTGAGACCTGTGTTGTACTT TCTACCCCACAGAATTATTTAGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 51, 3: 115, 4: 341} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!