ID: 1097643784_1097643787

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1097643784 1097643787
Species Human (GRCh38) Human (GRCh38)
Location 12:62212108-62212130 12:62212127-62212149
Sequence CCTTTGTGATTCAAGATATACAG ACAGCAAATCAGGGAAAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 184} {0: 1, 1: 0, 2: 3, 3: 30, 4: 322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!