|
Left Crispr |
Right Crispr |
| Crispr ID |
1097669164 |
1097669172 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:62515535-62515557
|
12:62515570-62515592
|
| Sequence |
CCCAGGTGCAGTGGTGCATGCCT |
CTTTGTAAGGCCAAGGTGGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 13, 2: 166, 3: 712, 4: 2045} |
{0: 1, 1: 79, 2: 2655, 3: 30187, 4: 87298} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|