|
Left Crispr |
Right Crispr |
| Crispr ID |
1097671648 |
1097671654 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:62546636-62546658
|
12:62546668-62546690
|
| Sequence |
CCCAGCTACTCAGGAGACTGAAG |
CACTTGAACCAAGGAGACGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 238, 1: 9790, 2: 118148, 3: 220290, 4: 240421} |
{0: 5, 1: 470, 2: 10453, 3: 51683, 4: 119056} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|