ID: 1097691171_1097691180

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1097691171 1097691180
Species Human (GRCh38) Human (GRCh38)
Location 12:62735898-62735920 12:62735938-62735960
Sequence CCTGGAAATGGAAGGTAGTTCTC ATGCCTGGTGGCAGTGGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 251} {0: 1, 1: 0, 2: 4, 3: 82, 4: 635}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!