ID: 1097716465_1097716468

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1097716465 1097716468
Species Human (GRCh38) Human (GRCh38)
Location 12:62971613-62971635 12:62971632-62971654
Sequence CCCTCAACCTTTTCATTTCTCAG TCAGAGTCTCCTACTTTTGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 21, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!